The eri-6/7 locus (Fischer et al., 2008) is defined by a number of mutations, most of which were isolated in a forward genetic screen for eri mutants. However, two mutations were not (Table 1). One mutation, eri-6/7(mg411), was found as a background mutation that causes a transgene silencing phenotype that was subsequently mapped to the eri-7 gene. This mutation was present in a Ruvkun and Ausubel lab N2 strain 10 years ago and thus was likely introduced into the background of the strains where it has been detected via backcrossing. The lesion was not found in any of the N2 strains currently held at the CGC. Another mutation, eri-6/7(mg441), was found in a strain acquired from the CGC and is a deletion of the eri-6 gene. It is likely to be a spontaneous deletion resulting from recombination between the direct repeats flanking this gene. Unlike other eri mutants, mutants of eri-6 and -7 do not display a temperature-sensitive sterility phenotype, or a high incidence of males phenotype. They do show a generally enhanced RNAi response, similar to eri-1(mg366), that can be easily tested in feeding RNAi assays for lin-1, hmr-1 and unc-73.
Table 1. Strains with background/spontaneous eri-6/7 mutations.
| Strain | Reported Genotype | Mutation | Rde Phenotype | Comments |
| GR1389 | mgIs30 | eri-7(mg411) | Eri on lin-1, unc-73, dpy-13, hmr-1 RNAi | Genotyping PCR: sequence a 300 bp PCR product; F:gccagtgcttcacgtgtcgg, R:aatacacacttgaagataatcc. mg411 is an A to T substitution |
| AU1 | sek-1(ag1) | eri-7(mg411) | ||
| AU3 | nsy-1(ag3) | eri-7(mg411) | ||
| CGC ??? | unknown | eri-6(mg441) | Complete deletion of eri-6. |
The prevalence of RNAi modulating mutations in laboratory stocks underscores the importance of assessing the RNAi efficacy of strains when performing RNAi-based experiments, especially when studying mutants that are tightly linked to the eri-6/7 locus.
References
Fischer SE, Butler MD, Pan Q, and Ruvkun G. (2008). Trans-splicing in C. elegans generates the negative RNAi regulator ERI-6/7. Nature 455, 491-6. 
